Enzo ALX-746-024-C100 AT-ODN-1 (endotoxin-free) (synthetic) (100 µg)

TLR, TLR9

Activator, Ligand

<0.0002EU/µg (LAL test; BioWhittaker)

Lyophilized. Sterile.

6413

15.7nmol

For a 100µM stock solution, dissolve the total vial content in 157µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure:- Add 50% of the solvent and let dissolve for 10 min.- Add remaining 50% of the solvent and mix thoroughly.- Moderate warming may aid dissolving.

TATAATTTTAATTTCCAAGA Nucleotides depicted in italics show the corresponding AT-ODN sequence.

Synthetic.

Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).

As indicated on product label or CoA when stored as recommended. Aqueous stock solution is stable for 1 day when stored at +4°C.

Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C.

+4°C

Ambient Temperature