Mfg Part Number
Ab00347-1.4

Vector Labs Ab00347-1.4 Anti-ssDNA/dsDNA [m3D8], Mouse IgG1, Fc Silent™, kappa (200 μg)

Quick Overview
3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
$517.40
Order will ship within 1-3 business days
Add to Wish List
Product Class:Purified
Expected Species Reactivity:Species Independent
Clone ID:m3D8
Heavy Chain Modification:Fc Silent™
Synonyms:single-/double-strand DNA; desoxyribonucleic acid; dsDNA; ssDNA
Amount:200 μg
Application Codes Clone:ELISA; hyrdolysis; SPR
Shipping Temperature:Wet Ice
Origin Pub PMID:16551636
Buffer Composition:PBS with 0.02% Proclin 300.
Original Format:IgG1
Storage Temperature:Store at 4⁰C for up to 3 months. For longer storage, aliquot and store at -20⁰C.
Specificity Statement:Binds unspecifically to double- and single-stranded DNA oligomers.
Application Notes:This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
More Information
Brand Vector Labs
UNSPSC 12161500