Mfg Part Number
Ab00347-1.7
Vector Labs Ab00347-1.7 Anti-ssDNA/dsDNA [m3D8], Mouse F(ab)2, AbFab2™ His-Tagged, kappa (200 μg)
Quick Overview
3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
$595.40
Order will ship within 1-3 business days
| Product Class: | Purified |
|---|---|
| Expected Species Reactivity: | Species Independent |
| Clone ID: | m3D8 |
| Heavy Chain Modification: | AbFab2™ His-Tagged |
| Synonyms: | single-/double-strand DNA; desoxyribonucleic acid; dsDNA; ssDNA |
| Amount: | 200 μg |
| Application Codes Clone: | ELISA; hyrdolysis; SPR |
| Shipping Temperature: | Wet Ice |
| Origin Pub PMID: | 16551636 |
| Buffer Composition: | PBS with 0.02% Proclin 300. |
| Original Format: | IgG1 |
| Storage Temperature: | Store at 4⁰C for up to 3 months. For longer storage, aliquot and store at -20⁰C. |
| Specificity Statement: | Binds unspecifically to double- and single-stranded DNA oligomers. |
| Application Notes: | This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease. |
| Brand | Vector Labs |
|---|---|
| UNSPSC | 12161500 |